The target DNA fragments were meticulously recovered and purified using the QIAquick Gel Extraction Kit (Qiagen, Germany). The purified amplicons were subjected to Illumina MiSeq sequencing by Beijing ...
After amplifying the V3-V4 region of 16S rRNA (341F, ACTCCTACGGGAGGCAGCAG and 806R, GGACTACHVGGGTWTCTAAT) and running an agarose gel, the bands were purified with a QIAquick Gel Extraction Kit (Qiagen ...
Learn more With more and more workers returning to the office, meal kits are making a comeback. Whether you're cooking for just one or your whole family, the best meal kits take all the guesswork ...
The kit allows for the isolation of RNA from both Gram negative and Gram positive bacteria, including E. coli, Proteus spp., Klebsiella spp., Enterobacter spp., Serratia spp., Pseudomonas spp ...
Life Kit is here to help you get it together. Want another life hack? Try Life Kit+. You'll support the show and unlock exclusive curated playlists and sponsor-free listening. Learn more at plus ...
After hours: February 20 at 6:40:00 PM EST ...
As the deputy editor who oversees Forbes Vetted’s beauty vertical, I rounded up the best teeth whitening kits based on recommendations from dentists and insights from five staff testers.
Meal kits and prepared meal delivery have changed weekday dinners for good. You don't have to run to the grocery store last minute or deal with the stress of figuring out what to make after a long ...
Free React Admin Dashboard made with Material-UI components and React + Vite.js.
An indoor-gardening kit is a relatively new entry in the home-appliance canon, which always makes me wonder if a product is here to stay or if it’s going to become obsolete. But after using an ...
In addition, while the original TaG-EM lines were made using a membrane-localized myr::GFP construct, variants that express GFP in other cell compartments such as the cytoplasm or nucleus could be ...