资讯

You’ll find key information about Restasis here: Drug class: calcineurin inhibitor immunosuppressants Drug form: Restasis is a liquid emulsion (an oily liquid mixture) that’s used as eye drops.
Considering this potential, the researchers developed a technique for integrating PGPB into a cellulose acetate-stabilized Pickering emulsion to create a multi-spectrum loading platform for the ...
Group attacked two men in Ahmedbad, one died on spot, another critical The murder occurred while police were sleeping just a few meters away Locals confronted police, recorded video; probe launched ...
5,6 Droplet digital PCR (ddPCR) is a digital PCR method that is based on water-oil emulsion droplet technology. The sample is fractionated into tens of thousands of droplets, which act as individual ...
2010). Briefly, DNA extracts from 10, 100, 120, and 200 m samples were amplified using SSU rRNA primers targeting the bacterial domain: B27F (5′- AGAGTTTGATCCTGGCTCAG) and U1492R (5′-GGTTAC ...
Du et al. (47) later setup a megaplex PCR strategy to characterize the antigen-specific TRBV repertoire from sorted IFNγ-producing cells after Mycobacterium infection. The clonotypic TRBV PCR products ...
Quantitative real-time technology dominates the market today but digital PCR is on the rise. A series of rodent experiments showed that even with abundant food and water, personal space is essential ...
In the recent past producers have sought to broaden the types of sealer materials available to the market, with asphalt emulsion-based products being the primary alternative. Other products ...